No assembly reported for 100 reads with the same sequence

[nh13]

@lh3 I was playing around with this tool but I couldn't get it to work on a "simple" case. I duplicated a read 100 times and would expect it to output the duplicated read. Any thoughts?

``` @M50205:20:000000000-B82KM:1:1108:8421:4217/2 CTAAGGTGGACATGTTGGCTTCTCTCTGTTCTTAACATGTTAAAATTAAAATTAACTTCTCTGGTGTGTGGAGATGTCTTACAATAACAGTTGCTACTATTTCTTTTCTTTTTCTCTTTCTTTCCTCTCTCTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTAGACAAGGTCTCAATTTGTCACTCAGAGTGAAGTGCATTGGCATGAACATTGCTCACTTCATCCTTAACCTTCTTGGCCAAAGAACTCCTCCTGCCTCACCCCC + 2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222 ```

[nh13]

I forgot to mention the context. I want to re-assembly a set of reads I know originate from the same haploid copy of the genome, and it's in a tandem repeat. All the reads should start/end around the same place, so it's a bit easier than assembly.

[lh3]

These 100 reads will be collapsed to one read. You will get a singleton contig, which will be ignored unless you tune parameters.

For cfDNA-like data, assembly may not work well.

[nh13]

That is actually what I want, a single contig at then end of the day. Think haploid variant calling across repeat regions with indel and mismatch errors. All reads would come from the same DNA molecule.

[nh13]

I am considering using this instead of consensus calling for duplex sequencing. In this case we have stutter due to PCR slippage across STRs.

[nh13]

Also, the introduction in the readme implied it would be suitable for re-assembly if short reads, even in runs of LOH. Would you mind sharing the tuning parameters you tube the parameters to output the single contig?

[lh3]

Your example is violating the basic assumption of assembly and won't happen in practice. You need to test on real data.

[nh13]

@lh3 challenge accepted, I'll send you a real world dataset where this can happen!

[nh13]

@lh3 I was wondering if you received the dataset of which I am speaking. I believe it would be a novel application of fermi-lite, where we aren't assembling a genome, but rather reconstructing a source molecule. You could see such applications as re-assembling reads from the same long-molecule (ex. 10x) or with novel sequencing preparations (ex. Duplex Sequencing) benefiting from proper assembly of reads from a single molecule.