Skip to content

Latest commit

 

History

History
executable file
·
421 lines (384 loc) · 28.1 KB

README.md

File metadata and controls

executable file
·
421 lines (384 loc) · 28.1 KB

umiCollapse

The incorporation of Unique Molecular Indices (UMIs) into sequenced reads allows for more accurate identification of PCR duplicates. This workflow extracts UMIs from the reads in fastq files, into the sequence identifier line. UMI identification is based on a known location and pattern and with the ability to match to a list of expected sequences. Reads are then aligned to a reference genome with bwa, and then the aligned sequence file is collapsed to remove duplicates with um-Tools

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run umiCollapse.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter Value Description
umiList String Reference file with valid UMIs
fastqInputs Array[FastqInputs] Array of fastq structs containing reads and readgroups
pattern1 String UMI pattern 1
pattern2 String UMI pattern 2
reference String Name and version of reference genome
mode String running mode for the workflow, only allow value 'lane_level' and 'call_ready'
bwaMem.reference String The genome reference build. For example: hg19, hg38, mm10
preDedupBamQC.bamQCMetrics_workflowVersion String Workflow version string
preDedupBamQC.bamQCMetrics_refSizesBed String Path to human genome BED reference with chromosome sizes
preDedupBamQC.bamQCMetrics_refFasta String Path to human genome FASTA reference
preDedupBamQC.metadata Map[String,String] JSON file containing metadata
postDedupBamQC.bamQCMetrics_workflowVersion String Workflow version string
postDedupBamQC.bamQCMetrics_refSizesBed String Path to human genome BED reference with chromosome sizes
postDedupBamQC.bamQCMetrics_refFasta String Path to human genome FASTA reference
postDedupBamQC.metadata Map[String,String] JSON file containing metadata

Optional workflow parameters:

Parameter Value Default Description
outputPrefix String "output" Specifies the prefix of output files
doBamQC Boolean false Enable/disable bamQC process
provisionBam Boolean true Enable/disable provision out umi deduplicated bam file

Optional task parameters:

Parameter Value Default Description
extractUMIs.modules String "barcodex-rs/0.1.2 rust/1.45.1" Required environment modules
extractUMIs.memory Int 24 Memory allocated for this job
extractUMIs.timeout Int 12 Time in hours before task timeout
bwaMem.adapterTrimmingLog_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimmingLog_jobMemory Int 12 Memory allocated indexing job
bwaMem.indexBam_timeout Int 48 Hours before task timeout
bwaMem.indexBam_modules String "samtools/1.9" Modules for running indexing job
bwaMem.indexBam_jobMemory Int 12 Memory allocated indexing job
bwaMem.bamMerge_timeout Int 72 Hours before task timeout
bwaMem.bamMerge_modules String "samtools/1.9" Required environment modules
bwaMem.bamMerge_jobMemory Int 32 Memory allocated indexing job
bwaMem.runBwaMem_timeout Int 96 Hours before task timeout
bwaMem.runBwaMem_jobMemory Int 32 Memory allocated for this job
bwaMem.runBwaMem_threads Int 8 Requested CPU threads
bwaMem.runBwaMem_addParam String? None Additional BWA parameters
bwaMem.adapterTrimming_timeout Int 48 Hours before task timeout
bwaMem.adapterTrimming_jobMemory Int 16 Memory allocated for this job
bwaMem.adapterTrimming_addParam String? None Additional cutadapt parameters
bwaMem.adapterTrimming_adapter2 String "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" Adapter sequence to trim from read 2
bwaMem.adapterTrimming_adapter1 String "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" Adapter sequence to trim from read 1
bwaMem.adapterTrimming_trimMinQuality Int 0 Minimum quality of read ends to keep
bwaMem.adapterTrimming_trimMinLength Int 1 Minimum length of reads to keep
bwaMem.adapterTrimming_umiLength Int 5 The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
bwaMem.adapterTrimming_doUMItrim Boolean false If true, do umi trimming
bwaMem.adapterTrimming_modules String "cutadapt/1.8.3" Required environment modules
bwaMem.extractUMIs_timeout Int 12 Time in hours before task timeout
bwaMem.extractUMIs_jobMemory Int 24 Memory allocated for this job
bwaMem.extractUMIs_modules String "barcodex-rs/0.1.2 rust/1.45.1" Required environment modules
bwaMem.extractUMIs_pattern2 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
bwaMem.extractUMIs_pattern1 String "(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T) (?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
bwaMem.extractUMIs_outputPrefix String "extractUMIs_output" Specifies the start of the output files
bwaMem.extractUMIs_umiList String "umiList" Reference file with valid UMIs
bwaMem.slicerR2_timeout Int 48 Hours before task timeout
bwaMem.slicerR2_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR2_modules String "slicer/0.3.0" Required environment modules
bwaMem.slicerR1_timeout Int 48 Hours before task timeout
bwaMem.slicerR1_jobMemory Int 16 Memory allocated for this job
bwaMem.slicerR1_modules String "slicer/0.3.0" Required environment modules
bwaMem.countChunkSize_timeout Int 48 Hours before task timeout
bwaMem.countChunkSize_jobMemory Int 16 Memory allocated for this job
bwaMem.countChunkSize_modules String "python/3.7" Required environment modules
bwaMem.numChunk Int 1 Number of chunks to split fastq file [1, no splitting]
bwaMem.doUMIextract Boolean false If true, UMI will be extracted before alignment [false]
bwaMem.doTrim Boolean false If true, adapters will be trimmed before alignment [false]
bwaMem.numReads Int? None Number of reads
mergeLibrary.modules String "samtools/1.9" Required environment modules
mergeLibrary.memory Int 24 Memory allocated for indexing job
mergeLibrary.timeout Int 6 Hours before task timeout
preDedupBamQC.collateResults_timeout Int 1 hours before task timeout
preDedupBamQC.collateResults_threads Int 4 Requested CPU threads
preDedupBamQC.collateResults_jobMemory Int 8 Memory allocated for this job
preDedupBamQC.collateResults_modules String "python/3.6" required environment modules
preDedupBamQC.cumulativeDistToHistogram_timeout Int 1 hours before task timeout
preDedupBamQC.cumulativeDistToHistogram_threads Int 4 Requested CPU threads
preDedupBamQC.cumulativeDistToHistogram_jobMemory Int 8 Memory allocated for this job
preDedupBamQC.cumulativeDistToHistogram_modules String "python/3.6" required environment modules
preDedupBamQC.runMosdepth_timeout Int 4 hours before task timeout
preDedupBamQC.runMosdepth_threads Int 4 Requested CPU threads
preDedupBamQC.runMosdepth_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.runMosdepth_modules String "mosdepth/0.2.9" required environment modules
preDedupBamQC.bamQCMetrics_timeout Int 4 hours before task timeout
preDedupBamQC.bamQCMetrics_threads Int 4 Requested CPU threads
preDedupBamQC.bamQCMetrics_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.bamQCMetrics_modules String "bam-qc-metrics/0.2.5" required environment modules
preDedupBamQC.bamQCMetrics_normalInsertMax Int 1500 Maximum of expected insert size range
preDedupBamQC.markDuplicates_timeout Int 4 hours before task timeout
preDedupBamQC.markDuplicates_threads Int 4 Requested CPU threads
preDedupBamQC.markDuplicates_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.markDuplicates_modules String "picard/2.21.2" required environment modules
preDedupBamQC.markDuplicates_picardMaxMemMb Int 6000 Memory requirement in MB for running Picard JAR
preDedupBamQC.markDuplicates_opticalDuplicatePixelDistance Int 100 Maximum offset between optical duplicate clusters
preDedupBamQC.downsampleRegion_timeout Int 4 hours before task timeout
preDedupBamQC.downsampleRegion_threads Int 4 Requested CPU threads
preDedupBamQC.downsampleRegion_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.downsampleRegion_modules String "samtools/1.14" required environment modules
preDedupBamQC.downsample_timeout Int 4 hours before task timeout
preDedupBamQC.downsample_threads Int 4 Requested CPU threads
preDedupBamQC.downsample_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.downsample_modules String "samtools/1.14" required environment modules
preDedupBamQC.downsample_randomSeed Int 42 Random seed for pre-downsampling (if any)
preDedupBamQC.downsample_downsampleSuffix String "downsampled.bam" Suffix for output file
preDedupBamQC.findDownsampleParamsMarkDup_timeout Int 4 hours before task timeout
preDedupBamQC.findDownsampleParamsMarkDup_threads Int 4 Requested CPU threads
preDedupBamQC.findDownsampleParamsMarkDup_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.findDownsampleParamsMarkDup_modules String "python/3.6" required environment modules
preDedupBamQC.findDownsampleParamsMarkDup_customRegions String "" Custom downsample regions; overrides chromosome and interval parameters
preDedupBamQC.findDownsampleParamsMarkDup_intervalStart Int 100000 Start of interval in each chromosome, for very large BAMs
preDedupBamQC.findDownsampleParamsMarkDup_baseInterval Int 15000 Base width of interval in each chromosome, for very large BAMs
preDedupBamQC.findDownsampleParamsMarkDup_chromosomes Array[String] ["chr12", "chr13", "chrXII", "chrXIII"] Array of chromosome identifiers for downsampled subset
preDedupBamQC.findDownsampleParamsMarkDup_threshold Int 10000000 Minimum number of reads to conduct downsampling
preDedupBamQC.findDownsampleParams_timeout Int 4 hours before task timeout
preDedupBamQC.findDownsampleParams_threads Int 4 Requested CPU threads
preDedupBamQC.findDownsampleParams_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.findDownsampleParams_modules String "python/3.6" required environment modules
preDedupBamQC.findDownsampleParams_preDSMultiplier Float 1.5 Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
preDedupBamQC.findDownsampleParams_precision Int 8 Number of decimal places in fraction for pre-downsampling
preDedupBamQC.findDownsampleParams_minReadsRelative Int 2 Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
preDedupBamQC.findDownsampleParams_minReadsAbsolute Int 10000 Minimum value of targetReads to allow pre-downsampling
preDedupBamQC.findDownsampleParams_targetReads Int 100000 Desired number of reads in downsampled output
preDedupBamQC.updateMetadata_timeout Int 4 hours before task timeout
preDedupBamQC.updateMetadata_threads Int 4 Requested CPU threads
preDedupBamQC.updateMetadata_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.updateMetadata_modules String "python/3.6" required environment modules
preDedupBamQC.filter_timeout Int 4 hours before task timeout
preDedupBamQC.filter_threads Int 4 Requested CPU threads
preDedupBamQC.filter_jobMemory Int 16 Memory allocated for this job
preDedupBamQC.filter_modules String "samtools/1.14" required environment modules
preDedupBamQC.filter_minQuality Int 30 Minimum alignment quality to pass filter
preDedupBamQC.mergeFiles_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
preDedupBamQC.mergeFiles_timeout Int 24 Maximum amount of time (in hours) the task can run for.
preDedupBamQC.mergeFiles_cores Int 1 The number of cores to allocate to the job.
preDedupBamQC.mergeFiles_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
preDedupBamQC.mergeFiles_jobMemory Int 24 Memory allocated to job (in GB).
preDedupBamQC.mergeFiles_suffix String ".merge" suffix to use for merged bam
preDedupBamQC.mergeSplitByIntervalFiles_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
preDedupBamQC.mergeSplitByIntervalFiles_timeout Int 24 Maximum amount of time (in hours) the task can run for.
preDedupBamQC.mergeSplitByIntervalFiles_cores Int 1 The number of cores to allocate to the job.
preDedupBamQC.mergeSplitByIntervalFiles_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
preDedupBamQC.mergeSplitByIntervalFiles_jobMemory Int 24 Memory allocated to job (in GB).
preDedupBamQC.mergeSplitByIntervalFiles_suffix String ".merge" suffix to use for merged bam
preDedupBamQC.preFilter_timeout Int 4 hours before task timeout
preDedupBamQC.preFilter_threads Int 4 Requested CPU threads
preDedupBamQC.preFilter_minMemory Int 2 Minimum amount of RAM allocated to the task
preDedupBamQC.preFilter_jobMemory Int 6 Memory allocated for this job
preDedupBamQC.preFilter_modules String "samtools/1.14" required environment modules
preDedupBamQC.preFilter_filterAdditionalParams String? None Additional parameters to pass to samtools.
preDedupBamQC.preFilter_minMapQuality Int? None Minimum alignment quality to pass filter
preDedupBamQC.preFilter_filterFlags Int 260 Samtools filter flags to apply.
preDedupBamQC.getChrCoefficient_modules String "samtools/1.14" Names and versions of modules to load
preDedupBamQC.getChrCoefficient_timeout Int 1 Hours before task timeout
preDedupBamQC.getChrCoefficient_memory Int 2 Memory allocated for this job
preDedupBamQC.splitStringToArray_modules String "" Environment module name and version to load (space separated) before command execution.
preDedupBamQC.splitStringToArray_timeout Int 1 Maximum amount of time (in hours) the task can run for.
preDedupBamQC.splitStringToArray_cores Int 1 The number of cores to allocate to the job.
preDedupBamQC.splitStringToArray_jobMemory Int 1 Memory allocated to job (in GB).
preDedupBamQC.splitStringToArray_recordSeparator String "+" Record separator - a delimiter for joining records
preDedupBamQC.splitStringToArray_lineSeparator String "," Interval group separator - these are the intervals to split by.
preDedupBamQC.intervalsToParallelizeByString String "chr1,chr2,chr3,chr4,chr5,chr6,chr7,chr8,chr9,chr10,chr11,chr12,chr13,chr14,chr15,chr16,chr17,chr18,chr19,chr20,chr21,chr22,chrX,chrY,chrM" Comma separated list of intervals to split by (e.g. chr1,chr2,chr3,chr4).
bamSplitDeduplication.modules String "umi-tools/1.0.0 samtools/1.9" Required environment modules
bamSplitDeduplication.memory Int 24 Memory allocated for this job
bamSplitDeduplication.timeout Int 6 Time in hours before task timeout
bamSplitDeduplication.method String "directional" What method to use to identify group of reads with the same (or similar) UMI(s)?
bamSplitDeduplication.editDistanceThreshold Int 1 Parametr for the adjacency and cluster methods, the threshold for the edit distance to connect two UMIs in the network.
bamMerge.modules String "samtools/1.9" Required environment modules
bamMerge.memory Int 24 Memory allocated for indexing job
bamMerge.timeout Int 6 Hours before task timeout
postDedupBamQC.collateResults_timeout Int 1 hours before task timeout
postDedupBamQC.collateResults_threads Int 4 Requested CPU threads
postDedupBamQC.collateResults_jobMemory Int 8 Memory allocated for this job
postDedupBamQC.collateResults_modules String "python/3.6" required environment modules
postDedupBamQC.cumulativeDistToHistogram_timeout Int 1 hours before task timeout
postDedupBamQC.cumulativeDistToHistogram_threads Int 4 Requested CPU threads
postDedupBamQC.cumulativeDistToHistogram_jobMemory Int 8 Memory allocated for this job
postDedupBamQC.cumulativeDistToHistogram_modules String "python/3.6" required environment modules
postDedupBamQC.runMosdepth_timeout Int 4 hours before task timeout
postDedupBamQC.runMosdepth_threads Int 4 Requested CPU threads
postDedupBamQC.runMosdepth_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.runMosdepth_modules String "mosdepth/0.2.9" required environment modules
postDedupBamQC.bamQCMetrics_timeout Int 4 hours before task timeout
postDedupBamQC.bamQCMetrics_threads Int 4 Requested CPU threads
postDedupBamQC.bamQCMetrics_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.bamQCMetrics_modules String "bam-qc-metrics/0.2.5" required environment modules
postDedupBamQC.bamQCMetrics_normalInsertMax Int 1500 Maximum of expected insert size range
postDedupBamQC.markDuplicates_timeout Int 4 hours before task timeout
postDedupBamQC.markDuplicates_threads Int 4 Requested CPU threads
postDedupBamQC.markDuplicates_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.markDuplicates_modules String "picard/2.21.2" required environment modules
postDedupBamQC.markDuplicates_picardMaxMemMb Int 6000 Memory requirement in MB for running Picard JAR
postDedupBamQC.markDuplicates_opticalDuplicatePixelDistance Int 100 Maximum offset between optical duplicate clusters
postDedupBamQC.downsampleRegion_timeout Int 4 hours before task timeout
postDedupBamQC.downsampleRegion_threads Int 4 Requested CPU threads
postDedupBamQC.downsampleRegion_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.downsampleRegion_modules String "samtools/1.14" required environment modules
postDedupBamQC.downsample_timeout Int 4 hours before task timeout
postDedupBamQC.downsample_threads Int 4 Requested CPU threads
postDedupBamQC.downsample_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.downsample_modules String "samtools/1.14" required environment modules
postDedupBamQC.downsample_randomSeed Int 42 Random seed for pre-downsampling (if any)
postDedupBamQC.downsample_downsampleSuffix String "downsampled.bam" Suffix for output file
postDedupBamQC.findDownsampleParamsMarkDup_timeout Int 4 hours before task timeout
postDedupBamQC.findDownsampleParamsMarkDup_threads Int 4 Requested CPU threads
postDedupBamQC.findDownsampleParamsMarkDup_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.findDownsampleParamsMarkDup_modules String "python/3.6" required environment modules
postDedupBamQC.findDownsampleParamsMarkDup_customRegions String "" Custom downsample regions; overrides chromosome and interval parameters
postDedupBamQC.findDownsampleParamsMarkDup_intervalStart Int 100000 Start of interval in each chromosome, for very large BAMs
postDedupBamQC.findDownsampleParamsMarkDup_baseInterval Int 15000 Base width of interval in each chromosome, for very large BAMs
postDedupBamQC.findDownsampleParamsMarkDup_chromosomes Array[String] ["chr12", "chr13", "chrXII", "chrXIII"] Array of chromosome identifiers for downsampled subset
postDedupBamQC.findDownsampleParamsMarkDup_threshold Int 10000000 Minimum number of reads to conduct downsampling
postDedupBamQC.findDownsampleParams_timeout Int 4 hours before task timeout
postDedupBamQC.findDownsampleParams_threads Int 4 Requested CPU threads
postDedupBamQC.findDownsampleParams_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.findDownsampleParams_modules String "python/3.6" required environment modules
postDedupBamQC.findDownsampleParams_preDSMultiplier Float 1.5 Determines target size for pre-downsampled set (if any). Must have (preDSMultiplier) < (minReadsRelative).
postDedupBamQC.findDownsampleParams_precision Int 8 Number of decimal places in fraction for pre-downsampling
postDedupBamQC.findDownsampleParams_minReadsRelative Int 2 Minimum value of (inputReads)/(targetReads) to allow pre-downsampling
postDedupBamQC.findDownsampleParams_minReadsAbsolute Int 10000 Minimum value of targetReads to allow pre-downsampling
postDedupBamQC.findDownsampleParams_targetReads Int 100000 Desired number of reads in downsampled output
postDedupBamQC.updateMetadata_timeout Int 4 hours before task timeout
postDedupBamQC.updateMetadata_threads Int 4 Requested CPU threads
postDedupBamQC.updateMetadata_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.updateMetadata_modules String "python/3.6" required environment modules
postDedupBamQC.filter_timeout Int 4 hours before task timeout
postDedupBamQC.filter_threads Int 4 Requested CPU threads
postDedupBamQC.filter_jobMemory Int 16 Memory allocated for this job
postDedupBamQC.filter_modules String "samtools/1.14" required environment modules
postDedupBamQC.filter_minQuality Int 30 Minimum alignment quality to pass filter
postDedupBamQC.mergeFiles_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
postDedupBamQC.mergeFiles_timeout Int 24 Maximum amount of time (in hours) the task can run for.
postDedupBamQC.mergeFiles_cores Int 1 The number of cores to allocate to the job.
postDedupBamQC.mergeFiles_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
postDedupBamQC.mergeFiles_jobMemory Int 24 Memory allocated to job (in GB).
postDedupBamQC.mergeFiles_suffix String ".merge" suffix to use for merged bam
postDedupBamQC.mergeSplitByIntervalFiles_modules String "gatk/4.1.6.0" Environment module name and version to load (space separated) before command execution.
postDedupBamQC.mergeSplitByIntervalFiles_timeout Int 24 Maximum amount of time (in hours) the task can run for.
postDedupBamQC.mergeSplitByIntervalFiles_cores Int 1 The number of cores to allocate to the job.
postDedupBamQC.mergeSplitByIntervalFiles_overhead Int 6 Java overhead memory (in GB). jobMemory - overhead == java Xmx/heap memory.
postDedupBamQC.mergeSplitByIntervalFiles_jobMemory Int 24 Memory allocated to job (in GB).
postDedupBamQC.mergeSplitByIntervalFiles_suffix String ".merge" suffix to use for merged bam
postDedupBamQC.preFilter_timeout Int 4 hours before task timeout
postDedupBamQC.preFilter_threads Int 4 Requested CPU threads
postDedupBamQC.preFilter_minMemory Int 2 Minimum amount of RAM allocated to the task
postDedupBamQC.preFilter_jobMemory Int 6 Memory allocated for this job
postDedupBamQC.preFilter_modules String "samtools/1.14" required environment modules
postDedupBamQC.preFilter_filterAdditionalParams String? None Additional parameters to pass to samtools.
postDedupBamQC.preFilter_minMapQuality Int? None Minimum alignment quality to pass filter
postDedupBamQC.preFilter_filterFlags Int 260 Samtools filter flags to apply.
postDedupBamQC.getChrCoefficient_modules String "samtools/1.14" Names and versions of modules to load
postDedupBamQC.getChrCoefficient_timeout Int 1 Hours before task timeout
postDedupBamQC.getChrCoefficient_memory Int 2 Memory allocated for this job
postDedupBamQC.splitStringToArray_modules String "" Environment module name and version to load (space separated) before command execution.
postDedupBamQC.splitStringToArray_timeout Int 1 Maximum amount of time (in hours) the task can run for.
postDedupBamQC.splitStringToArray_cores Int 1 The number of cores to allocate to the job.
postDedupBamQC.splitStringToArray_jobMemory Int 1 Memory allocated to job (in GB).
postDedupBamQC.splitStringToArray_recordSeparator String "+" Record separator - a delimiter for joining records
postDedupBamQC.splitStringToArray_lineSeparator String "," Interval group separator - these are the intervals to split by.
postDedupBamQC.intervalsToParallelizeByString String "chr1,chr2,chr3,chr4,chr5,chr6,chr7,chr8,chr9,chr10,chr11,chr12,chr13,chr14,chr15,chr16,chr17,chr18,chr19,chr20,chr21,chr22,chrX,chrY,chrM" Comma separated list of intervals to split by (e.g. chr1,chr2,chr3,chr4).
statsMerge.memory Int 16 Memory allocated for this job

Outputs

Output Type Description
deduplicatedBam File? Bam file after deduplication
statsEditDistance File tsv file reports the (binned) average edit distance between the UMIs at each position
umiCountsPerPosition File tsv file tabulates the counts for unique combinations of UMI and position
umiCounts File tsv file provides UMI-level summary statistics
preDedupBamMetrics File? pre-collapse bamqc metrics
postDedupBamMetrics File? post-collapse bamqc metrics

Commands

This section lists command(s) run by umiCollapse workflow

  • Running umiCollapse
      set -euo pipefail
      k=($(awk '{ match($1, "([ACTG])+"); print RLENGTH }' ~{umiList} | uniq))

      for i in ${k[@]}
      do
          for j in ${k[@]}
          do
              # adding 1 to account for period in UMI
              # 'ATG.ATCG'
              L+=($(($i+$j+1)))
          done
      done

      umiLengths=($(tr ' ' '\n' ``` "${L[@]}" | awk '!u[$0]++' | tr ' ' '\n'))
      printf "%s\n" "${umiLengths[@]}"

            set -euo pipefail
            barcodex-rs --umilist ~{umiList} --prefix ~{outputPrefix} --separator "__" inline \
            --pattern1 '~{pattern1}' --r1-in ~{fastq1} \
            --pattern2 '~{pattern2}' --r2-in ~{fastq2} 

            cat ~{outputPrefix}_UMI_counts.json > umiCounts.txt

            tr [,] ',\n' < umiCounts.txt | sed 's/[{}]//' > tmp.txt
            echo "{$(sort -i tmp.txt)}" > new.txt
            tr '\n' ',' < new.txt | sed 's/,$//' > ~{outputPrefix}_UMI_counts.json

        set -euo pipefail
        samtools view -H ~{bamFile} > ~{outputPrefix}.~{umiLength}.sam
        samtools view ~{bamFile} | grep -P "^.*__\S{~{umiLength}}\t" >> ~{outputPrefix}.~{umiLength}.sam
        samtools view -Sb ~{outputPrefix}.~{umiLength}.sam > ~{outputPrefix}.~{umiLength}.bam

        samtools index ~{outputPrefix}.~{umiLength}.bam

        umi_tools dedup -I ~{outputPrefix}.~{umiLength}.bam \
        -S deduplicated.bam \
        --method=~{method} \
        --edit-distance-threshold=~{editDistanceThreshold} \
        --output-stats=deduplicated 

        samtools merge -c ~{outputPrefix}.dedup.bam ~{sep=" " Bams}
        samtools index "~{outputPrefix}.dedup.bam"
        set -euo pipefail
        statsEditDistances=(~{sep=" " statsEditDistances})
        umiCountsPerPositions=(~{sep=" " umiCountsPerPositions})
        umiCountsArray=(~{sep=" " umiCountsArray})

        length=${#statsEditDistances[@]}
        touch stats.tsv
        i=0
        while [ $i -lt $length ]
        do
            cat stats.tsv > tmp.tsv
            awk  'BEGIN {OFS='\t'} \
            {s1[$5]+=$1; s2[$5]+=$2; s3[$5]+=$3; s4[$5]+=$4} \
            END {for (k in s1) print s1[k]"\t"s2[k]"\t"s3[k]"\t"s4[k]"\t"k}' \
            tmp.tsv <(tail -n +2 ${statsEditDistances[i]}) > stats.tsv
            i=$(( $i+1 )) 
        done
        sort -k5 -o stats.tsv stats.tsv
        cat <(head -n 1 ${statsEditDistances[0]}) stats.tsv > ~{outputPrefix}.statsEditDistance.tsv

        length=${#umiCountsPerPositions[@]}
        touch umi.tsv
        i=0
        while [ $i -lt $length ]
        do
            cat umi.tsv > tmp.tsv
            awk  '{s2[$1]+=$2; s3[$1]+=$3} \
            END {for (k in s2) print k"\t"s2[k]"\t"s3[k]}' \
            tmp.tsv <(tail -n +2 ${umiCountsPerPositions[i]}) > umi.tsv
            i=$(( $i+1 ))
        done
        cat <(head -n 1 ${umiCountsPerPositions[0]}) umi.tsv > ~{outputPrefix}.umiCountsPerPosition.tsv

        length=${#umiCountsArray[@]}
        head -n 1 ${umiCountsArray[0]} > umiCounts.tsv
        i=0
        while [ $i -lt $length ]
        do
            cat umiCounts.tsv > tmp.tsv
            cat tmp.tsv <(tail -n +2 ${umiCountsArray[i]}) > ~{outputPrefix}.umiCounts.tsv
            i=$(( $i+1 ))
        done

Support

For support, please file an issue on the Github project or send an email to [email protected] .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)