Skip to content
View omemishra's full-sized avatar
🏠
Working from home
🏠
Working from home
13 followers · 22 following

Achievements

Achievement: QuickdrawAchievement: YOLOAchievement: Pull SharkAchievement: Arctic Code Vault Contributor

Achievements

Achievement: QuickdrawAchievement: YOLOAchievement: Pull SharkAchievement: Arctic Code Vault Contributor
Block or Report

Block or report omemishra

Block user

Prevent this user from interacting with your repositories and sending you notifications. Learn more about blocking users.

You must be logged in to block users.

Please don't include any personal information such as legal names or email addresses. Maximum 100 characters, markdown supported. This note will be visible to only you.
Report abuse

Contact GitHub support about this user’s behavior. Learn more about reporting abuse.

Report abuse
omemishra/README.md

LinkedIn Badge

Buy Me A Coffee

Hey There Robots (*_*)

:Cyber Security Enthusiast:  About Me :

I am a Cyber Security Enthusiast and Bug Bounty Hunter from India.

  • 🔭 I Break Applications.
  • 🌱 Exploring Tools and Builds.
  • ⚡ In my free time I solve problems.
  • 📫 How to reach me:   Linkedin Badge

🛠  Languages and Tools :

Python  Shell  Java  CSS  HTML  JavaScript   

🔥   My Stats :

GitHub Streak

Top Langs

✍️ Blog Posts :

Popular repositories Loading

  1. DNA-Genetic-Python-Scripts-CTF DNA-Genetic-Python-Scripts-CTF Public

    a code written by me to decode the DNA Cipher (Genetic ) CTF challenge in which it is in the form of GAAACCACATATGATAAAACATAC

    Python 6 1

  2. PhishX-New-Fix PhishX-New-Fix Public

    New Fixes for the PHISHX Phishing Tool

    Python 6 8

  3. Redacted-Request Redacted-Request Public

    The "Redacted Request Extension" is a powerful tool designed to enhance the security and confidentiality of HTTP request handling within the Burp Suite.

    Python 3 1

  4. honeytrap honeytrap Public

    Forked from honeytrap/honeytrap

    Advanced Honeypot framework.

    Go 1

  5. Project-Automation Project-Automation Public

    This Is a tool build in python for the automation of VAPT so feel free to contribute if any one wants to.

    Python 1

  6. Duke Duke Public