I am a Cyber Security Enthusiast and Bug Bounty Hunter from India.
- 🔭 I Break Applications.
- 🌱 Exploring Tools and Builds.
- ⚡ In my free time I solve problems.
- 📫 How to reach me:
Contact GitHub support about this user’s behavior. Learn more about reporting abuse.
Report abusea code written by me to decode the DNA Cipher (Genetic ) CTF challenge in which it is in the form of GAAACCACATATGATAAAACATAC
The "Redacted Request Extension" is a powerful tool designed to enhance the security and confidentiality of HTTP request handling within the Burp Suite.
This Is a tool build in python for the automation of VAPT so feel free to contribute if any one wants to.
Python 1